Review





Similar Products

94
ATCC downstream workflows
Downstream Workflows, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/downstream workflows/product/ATCC
Average 94 stars, based on 1 article reviews
downstream workflows - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

99
Toyobo downstream primers
Downstream Primers, supplied by Toyobo, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/downstream primers/product/Toyobo
Average 99 stars, based on 1 article reviews
downstream primers - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

95
Addgene inc downstream cccagttaatatgcaccgaa 3
Downstream Cccagttaatatgcaccgaa 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/downstream cccagttaatatgcaccgaa 3/product/Addgene inc
Average 95 stars, based on 1 article reviews
downstream cccagttaatatgcaccgaa 3 - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

86
Macrogen downstream atac seq data analysis
(A) Chromosome-wide distribution of differentially accessible regions across all human autosomes. Each horizontal track represents an individual chromosome, arranged from chromosome 1 to chromosome 22. Up-DARs are indicated in red and Down-DARs in teal. Black and gray segments represent cytogenetic bands (cytobands) along each chromosome. The positions of DARs are shown relative to chromosomal coordinates, illustrating their genome-wide distribution. (B) Volcano plot showing differential chromatin accessibility between FSHD and control primary human myoblasts. Each point represents an <t>individual</t> <t>ATAC-seq</t> peak. The x-axis shows the log₂ fold change in accessibility (FSHD/CTRL), and the y-axis shows the −log₁₀(FDR). Regions with significantly increased accessibility in FSHD (Up-DARs) are shown in red, and regions with significantly decreased accessibility (Down-DARs) are shown in teal. Vertical dashed lines indicate fold-change thresholds, and the horizontal dashed line indicates the statistical significance threshold. ( 1 =chr19:42663366-42663803; 2 =chr8:125236306-125237721; 3 =chr4:37517813-37518483; 4 =chr15:84909779-84910176; 5 =chr7:146872319-146873047; 6 =chr1:180272411-18027321; 7 =chr7:41837735-41842398; 8 =chr7:146578703-146579358; 9 =chr7:147089937-147090658; 63012 =chr7:37253326-37254866; 63013 =chr8:11514184-11516273; 63014 =chr5:55485814-55486163; 63015 =chr21:30704676-30707177; 63024 =chr8:11518982-11519321). (C) Volcano plot showing differential chromatin accessibility between FSHD and control myotubes, displayed as in panel B. Each point represents an individual ATAC-seq peak, with Up-DARs shown in red and Down-DARs shown in teal. ( 1 =chr7:76053318-76053881; 2 =chr1:16126339-16127460; 3 =chr10:131229506-131231084; 4 =chr22:21699861-21700117; 5 =chr14:2770953-2771283; 6 =chr9:80192322-80193046; 7 =chr8:11514182-11516352; 8 = chr11:221023-221287; 9 =chr3:69747056-69747802). (D) Genomic annotation of Up-DARs identified in human primary myoblasts (HPMs; total = 5,102). Peaks were classified based on genomic location relative to annotated gene features, including promoter, exon, intron, 5′ untranslated region (UTR), 3′ UTR, downstream region, and distal intergenic region. Percentages and absolute counts are indicated. (E) Genomic annotation of Down-DARs identified in HPMs (total = 7,491), classified according to genomic features as in panel C. (F) Genomic annotation of Up-DARs identified in myotubes (total = 74), categorized according to genomic features as described above. (G) Genomic annotation of Down-DARs identified in myotubes (total = 89), categorized according to genomic features as described above.
Downstream Atac Seq Data Analysis, supplied by Macrogen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/downstream atac seq data analysis/product/Macrogen
Average 86 stars, based on 1 article reviews
downstream atac seq data analysis - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Galectin Therapeutics cytotoxicity downstream mediator galectin
(A) Chromosome-wide distribution of differentially accessible regions across all human autosomes. Each horizontal track represents an individual chromosome, arranged from chromosome 1 to chromosome 22. Up-DARs are indicated in red and Down-DARs in teal. Black and gray segments represent cytogenetic bands (cytobands) along each chromosome. The positions of DARs are shown relative to chromosomal coordinates, illustrating their genome-wide distribution. (B) Volcano plot showing differential chromatin accessibility between FSHD and control primary human myoblasts. Each point represents an <t>individual</t> <t>ATAC-seq</t> peak. The x-axis shows the log₂ fold change in accessibility (FSHD/CTRL), and the y-axis shows the −log₁₀(FDR). Regions with significantly increased accessibility in FSHD (Up-DARs) are shown in red, and regions with significantly decreased accessibility (Down-DARs) are shown in teal. Vertical dashed lines indicate fold-change thresholds, and the horizontal dashed line indicates the statistical significance threshold. ( 1 =chr19:42663366-42663803; 2 =chr8:125236306-125237721; 3 =chr4:37517813-37518483; 4 =chr15:84909779-84910176; 5 =chr7:146872319-146873047; 6 =chr1:180272411-18027321; 7 =chr7:41837735-41842398; 8 =chr7:146578703-146579358; 9 =chr7:147089937-147090658; 63012 =chr7:37253326-37254866; 63013 =chr8:11514184-11516273; 63014 =chr5:55485814-55486163; 63015 =chr21:30704676-30707177; 63024 =chr8:11518982-11519321). (C) Volcano plot showing differential chromatin accessibility between FSHD and control myotubes, displayed as in panel B. Each point represents an individual ATAC-seq peak, with Up-DARs shown in red and Down-DARs shown in teal. ( 1 =chr7:76053318-76053881; 2 =chr1:16126339-16127460; 3 =chr10:131229506-131231084; 4 =chr22:21699861-21700117; 5 =chr14:2770953-2771283; 6 =chr9:80192322-80193046; 7 =chr8:11514182-11516352; 8 = chr11:221023-221287; 9 =chr3:69747056-69747802). (D) Genomic annotation of Up-DARs identified in human primary myoblasts (HPMs; total = 5,102). Peaks were classified based on genomic location relative to annotated gene features, including promoter, exon, intron, 5′ untranslated region (UTR), 3′ UTR, downstream region, and distal intergenic region. Percentages and absolute counts are indicated. (E) Genomic annotation of Down-DARs identified in HPMs (total = 7,491), classified according to genomic features as in panel C. (F) Genomic annotation of Up-DARs identified in myotubes (total = 74), categorized according to genomic features as described above. (G) Genomic annotation of Down-DARs identified in myotubes (total = 89), categorized according to genomic features as described above.
Cytotoxicity Downstream Mediator Galectin, supplied by Galectin Therapeutics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cytotoxicity downstream mediator galectin/product/Galectin Therapeutics
Average 86 stars, based on 1 article reviews
cytotoxicity downstream mediator galectin - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Twist Bioscience downstream flanking sequence
(A) Chromosome-wide distribution of differentially accessible regions across all human autosomes. Each horizontal track represents an individual chromosome, arranged from chromosome 1 to chromosome 22. Up-DARs are indicated in red and Down-DARs in teal. Black and gray segments represent cytogenetic bands (cytobands) along each chromosome. The positions of DARs are shown relative to chromosomal coordinates, illustrating their genome-wide distribution. (B) Volcano plot showing differential chromatin accessibility between FSHD and control primary human myoblasts. Each point represents an <t>individual</t> <t>ATAC-seq</t> peak. The x-axis shows the log₂ fold change in accessibility (FSHD/CTRL), and the y-axis shows the −log₁₀(FDR). Regions with significantly increased accessibility in FSHD (Up-DARs) are shown in red, and regions with significantly decreased accessibility (Down-DARs) are shown in teal. Vertical dashed lines indicate fold-change thresholds, and the horizontal dashed line indicates the statistical significance threshold. ( 1 =chr19:42663366-42663803; 2 =chr8:125236306-125237721; 3 =chr4:37517813-37518483; 4 =chr15:84909779-84910176; 5 =chr7:146872319-146873047; 6 =chr1:180272411-18027321; 7 =chr7:41837735-41842398; 8 =chr7:146578703-146579358; 9 =chr7:147089937-147090658; 63012 =chr7:37253326-37254866; 63013 =chr8:11514184-11516273; 63014 =chr5:55485814-55486163; 63015 =chr21:30704676-30707177; 63024 =chr8:11518982-11519321). (C) Volcano plot showing differential chromatin accessibility between FSHD and control myotubes, displayed as in panel B. Each point represents an individual ATAC-seq peak, with Up-DARs shown in red and Down-DARs shown in teal. ( 1 =chr7:76053318-76053881; 2 =chr1:16126339-16127460; 3 =chr10:131229506-131231084; 4 =chr22:21699861-21700117; 5 =chr14:2770953-2771283; 6 =chr9:80192322-80193046; 7 =chr8:11514182-11516352; 8 = chr11:221023-221287; 9 =chr3:69747056-69747802). (D) Genomic annotation of Up-DARs identified in human primary myoblasts (HPMs; total = 5,102). Peaks were classified based on genomic location relative to annotated gene features, including promoter, exon, intron, 5′ untranslated region (UTR), 3′ UTR, downstream region, and distal intergenic region. Percentages and absolute counts are indicated. (E) Genomic annotation of Down-DARs identified in HPMs (total = 7,491), classified according to genomic features as in panel C. (F) Genomic annotation of Up-DARs identified in myotubes (total = 74), categorized according to genomic features as described above. (G) Genomic annotation of Down-DARs identified in myotubes (total = 89), categorized according to genomic features as described above.
Downstream Flanking Sequence, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/downstream flanking sequence/product/Twist Bioscience
Average 86 stars, based on 1 article reviews
downstream flanking sequence - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

99
Bruker Corporation downstream bruker maldi biotyper sirius ca
(A) Chromosome-wide distribution of differentially accessible regions across all human autosomes. Each horizontal track represents an individual chromosome, arranged from chromosome 1 to chromosome 22. Up-DARs are indicated in red and Down-DARs in teal. Black and gray segments represent cytogenetic bands (cytobands) along each chromosome. The positions of DARs are shown relative to chromosomal coordinates, illustrating their genome-wide distribution. (B) Volcano plot showing differential chromatin accessibility between FSHD and control primary human myoblasts. Each point represents an <t>individual</t> <t>ATAC-seq</t> peak. The x-axis shows the log₂ fold change in accessibility (FSHD/CTRL), and the y-axis shows the −log₁₀(FDR). Regions with significantly increased accessibility in FSHD (Up-DARs) are shown in red, and regions with significantly decreased accessibility (Down-DARs) are shown in teal. Vertical dashed lines indicate fold-change thresholds, and the horizontal dashed line indicates the statistical significance threshold. ( 1 =chr19:42663366-42663803; 2 =chr8:125236306-125237721; 3 =chr4:37517813-37518483; 4 =chr15:84909779-84910176; 5 =chr7:146872319-146873047; 6 =chr1:180272411-18027321; 7 =chr7:41837735-41842398; 8 =chr7:146578703-146579358; 9 =chr7:147089937-147090658; 63012 =chr7:37253326-37254866; 63013 =chr8:11514184-11516273; 63014 =chr5:55485814-55486163; 63015 =chr21:30704676-30707177; 63024 =chr8:11518982-11519321). (C) Volcano plot showing differential chromatin accessibility between FSHD and control myotubes, displayed as in panel B. Each point represents an individual ATAC-seq peak, with Up-DARs shown in red and Down-DARs shown in teal. ( 1 =chr7:76053318-76053881; 2 =chr1:16126339-16127460; 3 =chr10:131229506-131231084; 4 =chr22:21699861-21700117; 5 =chr14:2770953-2771283; 6 =chr9:80192322-80193046; 7 =chr8:11514182-11516352; 8 = chr11:221023-221287; 9 =chr3:69747056-69747802). (D) Genomic annotation of Up-DARs identified in human primary myoblasts (HPMs; total = 5,102). Peaks were classified based on genomic location relative to annotated gene features, including promoter, exon, intron, 5′ untranslated region (UTR), 3′ UTR, downstream region, and distal intergenic region. Percentages and absolute counts are indicated. (E) Genomic annotation of Down-DARs identified in HPMs (total = 7,491), classified according to genomic features as in panel C. (F) Genomic annotation of Up-DARs identified in myotubes (total = 74), categorized according to genomic features as described above. (G) Genomic annotation of Down-DARs identified in myotubes (total = 89), categorized according to genomic features as described above.
Downstream Bruker Maldi Biotyper Sirius Ca, supplied by Bruker Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/downstream bruker maldi biotyper sirius ca/product/Bruker Corporation
Average 99 stars, based on 1 article reviews
downstream bruker maldi biotyper sirius ca - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

97
ATCC taelo2 orf upstream sequence t aureum atcc 34304 derived ubiquitin promoter sequence hygr taelo2 orf downstream sequence
(A) Chromosome-wide distribution of differentially accessible regions across all human autosomes. Each horizontal track represents an individual chromosome, arranged from chromosome 1 to chromosome 22. Up-DARs are indicated in red and Down-DARs in teal. Black and gray segments represent cytogenetic bands (cytobands) along each chromosome. The positions of DARs are shown relative to chromosomal coordinates, illustrating their genome-wide distribution. (B) Volcano plot showing differential chromatin accessibility between FSHD and control primary human myoblasts. Each point represents an <t>individual</t> <t>ATAC-seq</t> peak. The x-axis shows the log₂ fold change in accessibility (FSHD/CTRL), and the y-axis shows the −log₁₀(FDR). Regions with significantly increased accessibility in FSHD (Up-DARs) are shown in red, and regions with significantly decreased accessibility (Down-DARs) are shown in teal. Vertical dashed lines indicate fold-change thresholds, and the horizontal dashed line indicates the statistical significance threshold. ( 1 =chr19:42663366-42663803; 2 =chr8:125236306-125237721; 3 =chr4:37517813-37518483; 4 =chr15:84909779-84910176; 5 =chr7:146872319-146873047; 6 =chr1:180272411-18027321; 7 =chr7:41837735-41842398; 8 =chr7:146578703-146579358; 9 =chr7:147089937-147090658; 63012 =chr7:37253326-37254866; 63013 =chr8:11514184-11516273; 63014 =chr5:55485814-55486163; 63015 =chr21:30704676-30707177; 63024 =chr8:11518982-11519321). (C) Volcano plot showing differential chromatin accessibility between FSHD and control myotubes, displayed as in panel B. Each point represents an individual ATAC-seq peak, with Up-DARs shown in red and Down-DARs shown in teal. ( 1 =chr7:76053318-76053881; 2 =chr1:16126339-16127460; 3 =chr10:131229506-131231084; 4 =chr22:21699861-21700117; 5 =chr14:2770953-2771283; 6 =chr9:80192322-80193046; 7 =chr8:11514182-11516352; 8 = chr11:221023-221287; 9 =chr3:69747056-69747802). (D) Genomic annotation of Up-DARs identified in human primary myoblasts (HPMs; total = 5,102). Peaks were classified based on genomic location relative to annotated gene features, including promoter, exon, intron, 5′ untranslated region (UTR), 3′ UTR, downstream region, and distal intergenic region. Percentages and absolute counts are indicated. (E) Genomic annotation of Down-DARs identified in HPMs (total = 7,491), classified according to genomic features as in panel C. (F) Genomic annotation of Up-DARs identified in myotubes (total = 74), categorized according to genomic features as described above. (G) Genomic annotation of Down-DARs identified in myotubes (total = 89), categorized according to genomic features as described above.
Taelo2 Orf Upstream Sequence T Aureum Atcc 34304 Derived Ubiquitin Promoter Sequence Hygr Taelo2 Orf Downstream Sequence, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taelo2 orf upstream sequence t aureum atcc 34304 derived ubiquitin promoter sequence hygr taelo2 orf downstream sequence/product/ATCC
Average 97 stars, based on 1 article reviews
taelo2 orf upstream sequence t aureum atcc 34304 derived ubiquitin promoter sequence hygr taelo2 orf downstream sequence - by Bioz Stars, 2026-05
97/100 stars
  Buy from Supplier

Image Search Results


(A) Chromosome-wide distribution of differentially accessible regions across all human autosomes. Each horizontal track represents an individual chromosome, arranged from chromosome 1 to chromosome 22. Up-DARs are indicated in red and Down-DARs in teal. Black and gray segments represent cytogenetic bands (cytobands) along each chromosome. The positions of DARs are shown relative to chromosomal coordinates, illustrating their genome-wide distribution. (B) Volcano plot showing differential chromatin accessibility between FSHD and control primary human myoblasts. Each point represents an individual ATAC-seq peak. The x-axis shows the log₂ fold change in accessibility (FSHD/CTRL), and the y-axis shows the −log₁₀(FDR). Regions with significantly increased accessibility in FSHD (Up-DARs) are shown in red, and regions with significantly decreased accessibility (Down-DARs) are shown in teal. Vertical dashed lines indicate fold-change thresholds, and the horizontal dashed line indicates the statistical significance threshold. ( 1 =chr19:42663366-42663803; 2 =chr8:125236306-125237721; 3 =chr4:37517813-37518483; 4 =chr15:84909779-84910176; 5 =chr7:146872319-146873047; 6 =chr1:180272411-18027321; 7 =chr7:41837735-41842398; 8 =chr7:146578703-146579358; 9 =chr7:147089937-147090658; 63012 =chr7:37253326-37254866; 63013 =chr8:11514184-11516273; 63014 =chr5:55485814-55486163; 63015 =chr21:30704676-30707177; 63024 =chr8:11518982-11519321). (C) Volcano plot showing differential chromatin accessibility between FSHD and control myotubes, displayed as in panel B. Each point represents an individual ATAC-seq peak, with Up-DARs shown in red and Down-DARs shown in teal. ( 1 =chr7:76053318-76053881; 2 =chr1:16126339-16127460; 3 =chr10:131229506-131231084; 4 =chr22:21699861-21700117; 5 =chr14:2770953-2771283; 6 =chr9:80192322-80193046; 7 =chr8:11514182-11516352; 8 = chr11:221023-221287; 9 =chr3:69747056-69747802). (D) Genomic annotation of Up-DARs identified in human primary myoblasts (HPMs; total = 5,102). Peaks were classified based on genomic location relative to annotated gene features, including promoter, exon, intron, 5′ untranslated region (UTR), 3′ UTR, downstream region, and distal intergenic region. Percentages and absolute counts are indicated. (E) Genomic annotation of Down-DARs identified in HPMs (total = 7,491), classified according to genomic features as in panel C. (F) Genomic annotation of Up-DARs identified in myotubes (total = 74), categorized according to genomic features as described above. (G) Genomic annotation of Down-DARs identified in myotubes (total = 89), categorized according to genomic features as described above.

Journal: bioRxiv

Article Title: Stage-dependent chromatin accessibility remodeling defines an architectural state in facioscapulohumeral muscular dystrophy myoblasts

doi: 10.64898/2026.03.06.710110

Figure Lengend Snippet: (A) Chromosome-wide distribution of differentially accessible regions across all human autosomes. Each horizontal track represents an individual chromosome, arranged from chromosome 1 to chromosome 22. Up-DARs are indicated in red and Down-DARs in teal. Black and gray segments represent cytogenetic bands (cytobands) along each chromosome. The positions of DARs are shown relative to chromosomal coordinates, illustrating their genome-wide distribution. (B) Volcano plot showing differential chromatin accessibility between FSHD and control primary human myoblasts. Each point represents an individual ATAC-seq peak. The x-axis shows the log₂ fold change in accessibility (FSHD/CTRL), and the y-axis shows the −log₁₀(FDR). Regions with significantly increased accessibility in FSHD (Up-DARs) are shown in red, and regions with significantly decreased accessibility (Down-DARs) are shown in teal. Vertical dashed lines indicate fold-change thresholds, and the horizontal dashed line indicates the statistical significance threshold. ( 1 =chr19:42663366-42663803; 2 =chr8:125236306-125237721; 3 =chr4:37517813-37518483; 4 =chr15:84909779-84910176; 5 =chr7:146872319-146873047; 6 =chr1:180272411-18027321; 7 =chr7:41837735-41842398; 8 =chr7:146578703-146579358; 9 =chr7:147089937-147090658; 63012 =chr7:37253326-37254866; 63013 =chr8:11514184-11516273; 63014 =chr5:55485814-55486163; 63015 =chr21:30704676-30707177; 63024 =chr8:11518982-11519321). (C) Volcano plot showing differential chromatin accessibility between FSHD and control myotubes, displayed as in panel B. Each point represents an individual ATAC-seq peak, with Up-DARs shown in red and Down-DARs shown in teal. ( 1 =chr7:76053318-76053881; 2 =chr1:16126339-16127460; 3 =chr10:131229506-131231084; 4 =chr22:21699861-21700117; 5 =chr14:2770953-2771283; 6 =chr9:80192322-80193046; 7 =chr8:11514182-11516352; 8 = chr11:221023-221287; 9 =chr3:69747056-69747802). (D) Genomic annotation of Up-DARs identified in human primary myoblasts (HPMs; total = 5,102). Peaks were classified based on genomic location relative to annotated gene features, including promoter, exon, intron, 5′ untranslated region (UTR), 3′ UTR, downstream region, and distal intergenic region. Percentages and absolute counts are indicated. (E) Genomic annotation of Down-DARs identified in HPMs (total = 7,491), classified according to genomic features as in panel C. (F) Genomic annotation of Up-DARs identified in myotubes (total = 74), categorized according to genomic features as described above. (G) Genomic annotation of Down-DARs identified in myotubes (total = 89), categorized according to genomic features as described above.

Article Snippet: Primary read processing and downstream ATAC-seq data analysis were performed by Macrogen (Seoul, South Korea).

Techniques: Genome Wide, Control

Journal: bioRxiv

Article Title: Stage-dependent chromatin accessibility remodeling defines an architectural state in facioscapulohumeral muscular dystrophy myoblasts

doi: 10.64898/2026.03.06.710110

Figure Lengend Snippet:

Article Snippet: Primary read processing and downstream ATAC-seq data analysis were performed by Macrogen (Seoul, South Korea).

Techniques:

(A) TSS enrichment profile showing the distribution of ATAC-seq signal centered on annotated transcription start sites (TSS). The x-axis indicates the distance from the TSS (kb), and the y-axis shows the smoothed peak density. Profiles are shown separately for regions with increased accessibility in FSHD (Up-DARs, red) and decreased accessibility in FSHD (Down-DARs, teal). (B) Distribution of differentially accessible regions overlapping promoter regions of protein-coding genes. Promoter-associated DARs were categorized based on their distance from the TSS: proximal promoter (≤1 kb), intermediate promoter (1–2 kb), and distal promoter (2–3 kb). Pie charts show the proportion and absolute counts of Up-DARs (total = 467) and Down-DARs (total = 468) in each promoter interval. (C) Volcano plot showing chromatin accessibility changes at promoter regions of protein-coding genes. Each point represents an individual promoter-associated ATAC-seq peak. The x-axis indicates log₂ fold change (FSHD/CTRL), and the y-axis shows −log₁₀(FDR). Up-DARs are shown in red and Down-DARs in teal. Selected genes are labeled. Bar plots on the left and right show selected Gene Ontology (GO) biological process terms associated with genes linked to Down-DARs and Up-DARs, respectively. The x-axis indicates −log₁₀(adjusted P-value). (D) Representative Integrative Genomics Viewer (IGV) screenshot showing an example of a DOWN-DAR overlapping a promoter region of a protein-coding gene. ATAC-seq signal tracks (scale 0-150) from control and FSHD samples are shown aligned to genomic coordinates. (E) Representative IGV screenshot showing an example of a UP-DAR overlapping a promoter region of a protein-coding gene (scale 0-130), displayed as described in panel D. (F) Distribution of peak width for promoter-associated DARs. Violin plots show peak dimension (kb) for Up-DARs and Down-DARs stratified by promoter distance category (proximal, intermediate, distal) and combined categories. Individual data points and median values are shown. Statistical significance is indicated (****). (G) Motif enrichment analysis for transcription factor binding motifs within promoter regions associated with Down-DARs. Each point represents a transcription factor motif. The x-axis shows log₂ odds ratio, and the y-axis shows −log₁₀(q-value). Selected transcription factors are labeled. (H) Motif enrichment analysis for transcription factor binding motifs within promoter regions associated with Up-DARs. Each point represents a transcription factor motif. The x-axis shows log₂ odds ratio, and the y-axis shows −log₁₀(q-value). Selected transcription factors are labeled.

Journal: bioRxiv

Article Title: Stage-dependent chromatin accessibility remodeling defines an architectural state in facioscapulohumeral muscular dystrophy myoblasts

doi: 10.64898/2026.03.06.710110

Figure Lengend Snippet: (A) TSS enrichment profile showing the distribution of ATAC-seq signal centered on annotated transcription start sites (TSS). The x-axis indicates the distance from the TSS (kb), and the y-axis shows the smoothed peak density. Profiles are shown separately for regions with increased accessibility in FSHD (Up-DARs, red) and decreased accessibility in FSHD (Down-DARs, teal). (B) Distribution of differentially accessible regions overlapping promoter regions of protein-coding genes. Promoter-associated DARs were categorized based on their distance from the TSS: proximal promoter (≤1 kb), intermediate promoter (1–2 kb), and distal promoter (2–3 kb). Pie charts show the proportion and absolute counts of Up-DARs (total = 467) and Down-DARs (total = 468) in each promoter interval. (C) Volcano plot showing chromatin accessibility changes at promoter regions of protein-coding genes. Each point represents an individual promoter-associated ATAC-seq peak. The x-axis indicates log₂ fold change (FSHD/CTRL), and the y-axis shows −log₁₀(FDR). Up-DARs are shown in red and Down-DARs in teal. Selected genes are labeled. Bar plots on the left and right show selected Gene Ontology (GO) biological process terms associated with genes linked to Down-DARs and Up-DARs, respectively. The x-axis indicates −log₁₀(adjusted P-value). (D) Representative Integrative Genomics Viewer (IGV) screenshot showing an example of a DOWN-DAR overlapping a promoter region of a protein-coding gene. ATAC-seq signal tracks (scale 0-150) from control and FSHD samples are shown aligned to genomic coordinates. (E) Representative IGV screenshot showing an example of a UP-DAR overlapping a promoter region of a protein-coding gene (scale 0-130), displayed as described in panel D. (F) Distribution of peak width for promoter-associated DARs. Violin plots show peak dimension (kb) for Up-DARs and Down-DARs stratified by promoter distance category (proximal, intermediate, distal) and combined categories. Individual data points and median values are shown. Statistical significance is indicated (****). (G) Motif enrichment analysis for transcription factor binding motifs within promoter regions associated with Down-DARs. Each point represents a transcription factor motif. The x-axis shows log₂ odds ratio, and the y-axis shows −log₁₀(q-value). Selected transcription factors are labeled. (H) Motif enrichment analysis for transcription factor binding motifs within promoter regions associated with Up-DARs. Each point represents a transcription factor motif. The x-axis shows log₂ odds ratio, and the y-axis shows −log₁₀(q-value). Selected transcription factors are labeled.

Article Snippet: Primary read processing and downstream ATAC-seq data analysis were performed by Macrogen (Seoul, South Korea).

Techniques: Labeling, Control, Binding Assay

(A) Percentage of Down-DARs, Up-DARs, all DARs, and all ATAC-seq peaks overlapping nucleolus-associated domains (NADs). Bar plots show the fraction of regions overlapping NADs. Statistical significance was assessed using Fisher’s exact test relative to all ATAC-seq peaks, as indicated. (B) Chromosome-specific enrichment of DARs within nucleolus-associated domains (NADs). Heatmap showing log₂ odds ratio (OR) values for enrichment of Down-DARs and Up-DARs across chromosomes 1–22. Each row represents a chromosome, and columns indicate Down-DARs and Up-DARs. Color intensity corresponds to log₂(OR), and statistical significance is indicated. (C) Percentage of Down-DARs, Up-DARs, all DARs, and all ATAC-seq peaks overlapping lamina-associated domains (LADs). Bar plots show the fraction of regions overlapping LADs. Statistical significance was assessed using Fisher’s exact test relative to all ATAC-seq peaks, as indicated. (D) Chromosome-specific enrichment of DARs within lamina-associated domains (LADs). Heatmap showing log₂ odds ratio values for enrichment of Down-DARs and Up-DARs across chromosomes. Each row corresponds to a chromosome, and columns indicate Down-DARs and Up-DARs. Color intensity represents log₂(OR), and statistical significance is indicated. (E) Compartment enrichment analysis showing log₂ odds ratio values for enrichment of Down-DARs, Up-DARs, and DAR hotspots in NAD and LAD compartments. Values are shown together with corresponding confidence intervals. (F) Chromatin state composition of DARs. Stacked bar plots showing the fraction of Down-DARs and Up-DARs assigned to different chromatin states, including heterochromatin, weak transcription, weak enhancer, transcription elongation, strong enhancer, repressed, transcription transition, insulator, weak promoter, active promoter, poised promoter, and repetitive/CNV. (G) Chromatin state distribution of DARs across chromosomes. Bubble plots showing the percentage of DARs associated with each chromatin state across chromosomes 1–22 and chromosome X. Circle size represents the fraction of DARs, and color indicates log₂ odds ratio for enrichment. Separate panels are shown for Down-DARs and Up-DARs. (H) Enrichment of repeat element classes in Up-DARs. Bar plot showing log₂ odds ratio values for overlap between Up-DARs and annotated repeat classes, including LINE, SINE, DNA elements, simple repeats, and LTR elements. (I) Enrichment of repeat element classes in Down-DARs. Bar plot showing log₂ odds ratio values for overlap between Down-DARs and annotated repeat classes, including LINE, SINE, simple repeats, low complexity regions, and tRNA elements.

Journal: bioRxiv

Article Title: Stage-dependent chromatin accessibility remodeling defines an architectural state in facioscapulohumeral muscular dystrophy myoblasts

doi: 10.64898/2026.03.06.710110

Figure Lengend Snippet: (A) Percentage of Down-DARs, Up-DARs, all DARs, and all ATAC-seq peaks overlapping nucleolus-associated domains (NADs). Bar plots show the fraction of regions overlapping NADs. Statistical significance was assessed using Fisher’s exact test relative to all ATAC-seq peaks, as indicated. (B) Chromosome-specific enrichment of DARs within nucleolus-associated domains (NADs). Heatmap showing log₂ odds ratio (OR) values for enrichment of Down-DARs and Up-DARs across chromosomes 1–22. Each row represents a chromosome, and columns indicate Down-DARs and Up-DARs. Color intensity corresponds to log₂(OR), and statistical significance is indicated. (C) Percentage of Down-DARs, Up-DARs, all DARs, and all ATAC-seq peaks overlapping lamina-associated domains (LADs). Bar plots show the fraction of regions overlapping LADs. Statistical significance was assessed using Fisher’s exact test relative to all ATAC-seq peaks, as indicated. (D) Chromosome-specific enrichment of DARs within lamina-associated domains (LADs). Heatmap showing log₂ odds ratio values for enrichment of Down-DARs and Up-DARs across chromosomes. Each row corresponds to a chromosome, and columns indicate Down-DARs and Up-DARs. Color intensity represents log₂(OR), and statistical significance is indicated. (E) Compartment enrichment analysis showing log₂ odds ratio values for enrichment of Down-DARs, Up-DARs, and DAR hotspots in NAD and LAD compartments. Values are shown together with corresponding confidence intervals. (F) Chromatin state composition of DARs. Stacked bar plots showing the fraction of Down-DARs and Up-DARs assigned to different chromatin states, including heterochromatin, weak transcription, weak enhancer, transcription elongation, strong enhancer, repressed, transcription transition, insulator, weak promoter, active promoter, poised promoter, and repetitive/CNV. (G) Chromatin state distribution of DARs across chromosomes. Bubble plots showing the percentage of DARs associated with each chromatin state across chromosomes 1–22 and chromosome X. Circle size represents the fraction of DARs, and color indicates log₂ odds ratio for enrichment. Separate panels are shown for Down-DARs and Up-DARs. (H) Enrichment of repeat element classes in Up-DARs. Bar plot showing log₂ odds ratio values for overlap between Up-DARs and annotated repeat classes, including LINE, SINE, DNA elements, simple repeats, and LTR elements. (I) Enrichment of repeat element classes in Down-DARs. Bar plot showing log₂ odds ratio values for overlap between Down-DARs and annotated repeat classes, including LINE, SINE, simple repeats, low complexity regions, and tRNA elements.

Article Snippet: Primary read processing and downstream ATAC-seq data analysis were performed by Macrogen (Seoul, South Korea).

Techniques: